<?xml version="1.0" encoding="UTF-8"?>
<rss xmlns:dc="http://purl.org/dc/elements/1.1/" version="2.0">
<channel>
<title>Faculty of Agriculture</title>
<link>https://hdl.handle.net/13049/5</link>
<description/>
<pubDate>Thu, 09 Apr 2026 04:00:50 GMT</pubDate>
<dc:date>2026-04-09T04:00:50Z</dc:date>
<item>
<title>First report of Passiflora virus Y infecting siratro (Macroptilium atropurpureum) in Botswana.</title>
<link>https://hdl.handle.net/13049/812</link>
<description>First report of Passiflora virus Y infecting siratro (Macroptilium atropurpureum) in Botswana.
Orebotswe, Oteng; Malambane, Goitseone; Segwagwe, Amogelang; Kelemoge, Donald Omphile; Menzel, Wulf; Abraham, Adane
Siratro (Macroptilium atropurpureum (DC.) Urb.) is a perennial legume used as a fodder crop in many countries. In Botswana, the plant occurs wild mainly near ploughed areas and roadsides. Since 2018, viral symptoms including mottling, mosaic with dark/light green, and yellowing of siratro leaves have been observed in the gardens of Botswana University of Agriculture and Natural Resources in Gaborone with 1–5% incidence. Initial testing of five symptomatic samples by antigen-coated Enzyme-Linked Immunosorbent Assay (ACP-ELISA) using potyvirus-specific monoclonal antibody from Agdia gave positive results indicating infection by a potyvirus. To accurately identify the virus species, RNA extracted by Trizol method from three symptomatic siratro samples collected in January 2023 was used in a single-step reverse transcription polymerase chain reaction (RT-PCR) using a pair of primers, LEGPOTY Forward (5-‘GCAGCAATGATCGAAGCATGGG-‘3) and Reverse (5ACCTGCTCATCACCATCCATC− 3’) that amplifies partial NIb and partial CP potyvirus sequences (Webster 2008) and the expected~ 660-bp PCR product was observed. Sanger-sequencing and BLASTN analysis revealed that the sequences were most closely related to those of Passiflora virus Y (species Potyvirus passiflory; PaVY) and had highest nucleotide identity of 98.06% with a Western Australian isolate (Accession No. JF427599). The representative sequence was deposited in public database as GenBank Accession No. PQ333005. PaVY was first reported in Australia and Indonesia in 2004 (Parry et al. 2004) but has since been shown to infect various cultivated and wild passion fruit species as well as legumes including siratro and cultivated crops such as Vigna unguiculata and Pisum sativum in Asia and Australia (Coutts et al. 2011). This is the first report on PaVY and its infection of siratro in Botswana and Africa. Further studies are required to determine its other hosts, especially among cultivated crops and its geographical distribution in the content.
</description>
<pubDate>Tue, 03 Feb 2026 00:00:00 GMT</pubDate>
<guid isPermaLink="false">https://hdl.handle.net/13049/812</guid>
<dc:date>2026-02-03T00:00:00Z</dc:date>
</item>
<item>
<title>Distribution, traditional utilization, processing, and health benefits associated with the consumption of morama bean [Tylosema escululetum (Burch.)]: a survey from selected districts of Botswana</title>
<link>https://hdl.handle.net/13049/804</link>
<description>Distribution, traditional utilization, processing, and health benefits associated with the consumption of morama bean [Tylosema escululetum (Burch.)]: a survey from selected districts of Botswana
Gwamba, John; Imathiu, Samuel; Kinyuru, John; Onyango, Arnold; Motaung, Masa Veronica
Morama bean [Tylosema escululetum (Burch.)] is a nutrient-dense underutilized legume that can address proteinenergy and micronutrient malnutrition in developing countries. An ethnographic study using a snowball sampling&#13;
method was conducted in Kweneng, Ghanzi, Southern, and Central districts of Botswana. The survey sought to gather&#13;
and document information about demographic characteristics, traditional use, cultural norms, harvesting, processing, preservation, and health benefits of morama beans. A 5-point Likert-type scale was used to assess and rate&#13;
the respondent(s) perceptions on traditional utilization and potential of the bean. The data was analyzed using&#13;
Statistical Package for the Social Sciences (SPSS) and thematic grouping. It was found that morama bean is distributed&#13;
in Botswana’s sandy desert regions and is consumed by people who are native or migrated into these areas. Roasting&#13;
in heated sand (mean=4.93) and boiling fresh beans with water or milk (mean=4.49) were the most popular methods of cooking morama beans. Across the four districts, morama bean was found to be an important component&#13;
in traditional food and medicinal mixtures for undernourished infants, and expectant and lactating mothers, mostly&#13;
prepared with soft porridge. Respondents cited a significant lack of scientific knowledge about the bean’s medicinal&#13;
properties (mean=1.27–1.38), indicating the need for additional research. The nutritious density of morama beans&#13;
(mean=4.87) and their potential for processing into value-added products (mean=4.10) were known to the respondents. As a result, the bean has a high potential to improve food and nutrition security in these communities.
</description>
<pubDate>Mon, 03 Feb 2025 00:00:00 GMT</pubDate>
<guid isPermaLink="false">https://hdl.handle.net/13049/804</guid>
<dc:date>2025-02-03T00:00:00Z</dc:date>
</item>
<item>
<title>Distribution, traditional utilization, processing, and health benefits associated with the consumption of morama bean [Tylosema escululetum (Burch.)]: a survey from selected districts of Botswana</title>
<link>https://hdl.handle.net/13049/801</link>
<description>Distribution, traditional utilization, processing, and health benefits associated with the consumption of morama bean [Tylosema escululetum (Burch.)]: a survey from selected districts of Botswana
Gwamba, John; Imathiu, Samuel; Kinyuru, John; Onyango, Arnold; Motaung, Masa Veronica
Morama bean [Tylosema escululetum (Burch.)] is a nutrient-dense underutilized legume that can address proteinenergy and micronutrient malnutrition in developing countries. An ethnographic study using a snowball sampling method was conducted in Kweneng, Ghanzi, Southern, and Central districts of Botswana. The survey sought to gather and document information about demographic characteristics, traditional use, cultural norms, harvesting, processing, preservation, and health benefits of morama beans. A 5-point Likert-type scale was used to assess and rate the respondent(s) perceptions on traditional utilization and potential of the bean. The data was analyzed using Statistical Package for the Social Sciences (SPSS) and thematic grouping. It was found that morama bean is distributed in Botswana’s sandy desert regions and is consumed by people who are native or migrated into these areas. Roasting in heated sand (mean=4.93) and boiling fresh beans with water or milk (mean=4.49) were the most popular methods of cooking morama beans. Across the four districts, morama bean was found to be an important component in traditional food and medicinal mixtures for undernourished infants, and expectant and lactating mothers, mostly prepared with soft porridge. Respondents cited a significant lack of scientific knowledge about the bean’s medicinal properties (mean=1.27–1.38), indicating the need for additional research. The nutritious density of morama beans (mean=4.87) and their potential for processing into value-added products (mean=4.10) were known to the respondents. As a result, the bean has a high potential to improve food and nutrition security in these communities.
</description>
<pubDate>Tue, 04 Feb 2025 00:00:00 GMT</pubDate>
<guid isPermaLink="false">https://hdl.handle.net/13049/801</guid>
<dc:date>2025-02-04T00:00:00Z</dc:date>
</item>
<item>
<title>Nutritional profile and bioactive contents of Englerophytum magalismontanum fruits from Botswana</title>
<link>https://hdl.handle.net/13049/800</link>
<description>Nutritional profile and bioactive contents of Englerophytum magalismontanum fruits from Botswana
Mokwena, Kaone Kgotla; Bultosa, Geremew; Seifu, Eyassu; Gwamba, John; Khumoetsile, Thabo
Among underutilized indigenous wild fruits, Englerophytum magalismontanum (Sond.) has the potential for nutritional improvement and economic development of arid and semi-arid regions. In view of this, E. magalismontanum fruits pulp collected from Kanye and Molepolole, Botswana was evaluated. Survey conducted to document on the traditional knowledge of E. magalismontanum fruits showed that the respondents were aware on fruits use for human consumption, jam, alcoholic and non-alcoholic beverage making. The proximate, mineral and vitamin C contents determined by Association of Official Analytical Chemists (AOAC) methods showed no significant difference (p &gt; 0.05) except for moisture and fat. The moisture content was 66.2 % for Molepolole and 70.6 % for Kanye and after drying (60 °C) reduced to 14.2 % and 16.2 %, respectively. The percentage ash, fiber, protein, fat, available carbohydrate (CHO) and vitamin C (mg/100 mL) contents were ranged 2.1–2.4, 4.9–5.2, 1.4–2.2, 2.0–3.5, 70.1–74.6, and 7.0–7.3, respectively and energy content was 17.7 kcal/100 g. Phytochemical tests showed presence of flavonoids, tannins, steroids, terpenoids and cardiac glycosides, and absence of alkaloids and saponins. The total phenolics and flavonoids contents determined using Folin-Ciocalteu and aluminium chloride methods showed significant variations (p &lt; 0.05) because of bioactive compounds biosynthesis variability with different environments. Variations in the mineral contents were insignificant (p &gt; 0.05) except for manganese and copper. The calcium, magnesium, phosphorus, manganese, iron, zinc, and copper contents (mg/100 g, db) were ranged 177.7–207.5, 105.6–112.9, 68.9–69.4, 5.1–9.9, 10.3–15.0, 4.2–4.7 and 0.5–1.1, respectively. The study showed the fruit bears a significant content of CHO, fiber, vitamin C, phenolics and minerals to support nutrition and for functional foods development. The E. magalismontanum fruits can be exploited for health benefits which can illuminate acceptability of wild fruits to ultimately motivate conservation. For future research, functional foods development using fruits, assays on bioavailability and antioxidants activities are recommended.
Journal article
</description>
<pubDate>Wed, 01 Jan 2025 00:00:00 GMT</pubDate>
<guid isPermaLink="false">https://hdl.handle.net/13049/800</guid>
<dc:date>2025-01-01T00:00:00Z</dc:date>
</item>
</channel>
</rss>
