<?xml version="1.0" encoding="UTF-8"?>
<feed xmlns="http://www.w3.org/2005/Atom" xmlns:dc="http://purl.org/dc/elements/1.1/">
<title>Faculty of Agriculture</title>
<link href="https://hdl.handle.net/13049/5" rel="alternate"/>
<subtitle/>
<id>https://hdl.handle.net/13049/5</id>
<updated>2026-09-01T07:50:49Z</updated>
<dc:date>2026-09-01T07:50:49Z</dc:date>
<entry>
<title>Child feeding style is associated with food intake and linear growth in rural Ethiopia</title>
<link href="https://hdl.handle.net/13049/823" rel="alternate"/>
<author>
<name>Abebe, Zeweter</name>
</author>
<author>
<name>Haki, Gulelat Desse</name>
</author>
<author>
<name>Baye, Kaleab</name>
</author>
<id>https://hdl.handle.net/13049/823</id>
<updated>2026-08-19T13:43:43Z</updated>
<published>2017-01-01T00:00:00Z</published>
<summary type="text">Child feeding style is associated with food intake and linear growth in rural Ethiopia
Abebe, Zeweter; Haki, Gulelat Desse; Baye, Kaleab
Background Little is known about mother-child feeding interactions and how this is associated with food intake and linear growth. Objective To characterize mother-child feeding styles and investigate their associations with accepted mouthful and linear growth in west Gojam, rural Ethiopia. Subjects/design Two, in-home, meal observations of children aged 12–23 months (n = 100) were video-taped. The number of mouthful accepted was counted and the caregiver/child feeding styles were coded into positive/negative categories of self-feeding, responsive-feeding, active-feeding, social-behavior and distraction. Data on socio-demographic characteristics, child feeding practices, perception about child's overall appetite, and strategies adopted to overcome food refusal were collected through questionnaire-based interviews. Child and mothers' anthropometric measurements were also taken. Results Stunting was highly prevalent (48%) and the number of mouthful accepted was very low. Offering breastmilk and threatening to harm were the main strategies adopted to overcome food refusal. Although all forms of feeding style were present, active positive feeding style was dominant (90%) and was positively associated with mouthful accepted. Talking with non-feeding partner (64%), and domestic animals (24%) surrounding the feeding place were common distractions of feeding. Feeding was mostly terminated by caregivers (75%), often prematurely. Overall, caregivers of stunted children had poorer complementary- and breast-feeding practices and were less responsive to child's hunger and satiation cues (P &lt; 0.05). Positive responsive feeding behaviors were associated with child's number of mouthful accepted (r = 0.27; P = 0.007) and stunting (r = 0.4; P &lt; 0.001). Conclusion Low complementary food intake in this setting is associated with caregivers’ feeding style and stunting. Nutrition interventions that reinforce messages of optimal infant and young child feeding and integrate the promotion of responsive feeding behaviors are needed.
Journal article
</summary>
<dc:date>2017-01-01T00:00:00Z</dc:date>
</entry>
<entry>
<title>First report of Passiflora virus Y infecting siratro (Macroptilium atropurpureum) in Botswana.</title>
<link href="https://hdl.handle.net/13049/812" rel="alternate"/>
<author>
<name>Orebotswe, Oteng</name>
</author>
<author>
<name>Malambane, Goitseone</name>
</author>
<author>
<name>Segwagwe, Amogelang</name>
</author>
<author>
<name>Kelemoge, Donald Omphile</name>
</author>
<author>
<name>Menzel, Wulf</name>
</author>
<author>
<name>Abraham, Adane</name>
</author>
<id>https://hdl.handle.net/13049/812</id>
<updated>2026-08-28T01:02:44Z</updated>
<published>2026-02-03T00:00:00Z</published>
<summary type="text">First report of Passiflora virus Y infecting siratro (Macroptilium atropurpureum) in Botswana.
Orebotswe, Oteng; Malambane, Goitseone; Segwagwe, Amogelang; Kelemoge, Donald Omphile; Menzel, Wulf; Abraham, Adane
Siratro (Macroptilium atropurpureum (DC.) Urb.) is a perennial legume used as a fodder crop in many countries. In Botswana, the plant occurs wild mainly near ploughed areas and roadsides. Since 2018, viral symptoms including mottling, mosaic with dark/light green, and yellowing of siratro leaves have been observed in the gardens of Botswana University of Agriculture and Natural Resources in Gaborone with 1–5% incidence. Initial testing of five symptomatic samples by antigen-coated Enzyme-Linked Immunosorbent Assay (ACP-ELISA) using potyvirus-specific monoclonal antibody from Agdia gave positive results indicating infection by a potyvirus. To accurately identify the virus species, RNA extracted by Trizol method from three symptomatic siratro samples collected in January 2023 was used in a single-step reverse transcription polymerase chain reaction (RT-PCR) using a pair of primers, LEGPOTY Forward (5-‘GCAGCAATGATCGAAGCATGGG-‘3) and Reverse (5ACCTGCTCATCACCATCCATC− 3’) that amplifies partial NIb and partial CP potyvirus sequences (Webster 2008) and the expected~ 660-bp PCR product was observed. Sanger-sequencing and BLASTN analysis revealed that the sequences were most closely related to those of Passiflora virus Y (species Potyvirus passiflory; PaVY) and had highest nucleotide identity of 98.06% with a Western Australian isolate (Accession No. JF427599). The representative sequence was deposited in public database as GenBank Accession No. PQ333005. PaVY was first reported in Australia and Indonesia in 2004 (Parry et al. 2004) but has since been shown to infect various cultivated and wild passion fruit species as well as legumes including siratro and cultivated crops such as Vigna unguiculata and Pisum sativum in Asia and Australia (Coutts et al. 2011). This is the first report on PaVY and its infection of siratro in Botswana and Africa. Further studies are required to determine its other hosts, especially among cultivated crops and its geographical distribution in the content.
</summary>
<dc:date>2026-02-03T00:00:00Z</dc:date>
</entry>
<entry>
<title>Distribution, traditional utilization, processing, and health benefits associated with the consumption of morama bean [Tylosema escululetum (Burch.)]: a survey from selected districts of Botswana</title>
<link href="https://hdl.handle.net/13049/804" rel="alternate"/>
<author>
<name>Gwamba, John</name>
</author>
<author>
<name>Imathiu, Samuel</name>
</author>
<author>
<name>Kinyuru, John</name>
</author>
<author>
<name>Onyango, Arnold</name>
</author>
<author>
<name>Motaung, Masa Veronica</name>
</author>
<id>https://hdl.handle.net/13049/804</id>
<updated>2026-08-28T01:02:51Z</updated>
<published>2025-02-03T00:00:00Z</published>
<summary type="text">Distribution, traditional utilization, processing, and health benefits associated with the consumption of morama bean [Tylosema escululetum (Burch.)]: a survey from selected districts of Botswana
Gwamba, John; Imathiu, Samuel; Kinyuru, John; Onyango, Arnold; Motaung, Masa Veronica
Morama bean [Tylosema escululetum (Burch.)] is a nutrient-dense underutilized legume that can address proteinenergy and micronutrient malnutrition in developing countries. An ethnographic study using a snowball sampling&#13;
method was conducted in Kweneng, Ghanzi, Southern, and Central districts of Botswana. The survey sought to gather&#13;
and document information about demographic characteristics, traditional use, cultural norms, harvesting, processing, preservation, and health benefits of morama beans. A 5-point Likert-type scale was used to assess and rate&#13;
the respondent(s) perceptions on traditional utilization and potential of the bean. The data was analyzed using&#13;
Statistical Package for the Social Sciences (SPSS) and thematic grouping. It was found that morama bean is distributed&#13;
in Botswana’s sandy desert regions and is consumed by people who are native or migrated into these areas. Roasting&#13;
in heated sand (mean=4.93) and boiling fresh beans with water or milk (mean=4.49) were the most popular methods of cooking morama beans. Across the four districts, morama bean was found to be an important component&#13;
in traditional food and medicinal mixtures for undernourished infants, and expectant and lactating mothers, mostly&#13;
prepared with soft porridge. Respondents cited a significant lack of scientific knowledge about the bean’s medicinal&#13;
properties (mean=1.27–1.38), indicating the need for additional research. The nutritious density of morama beans&#13;
(mean=4.87) and their potential for processing into value-added products (mean=4.10) were known to the respondents. As a result, the bean has a high potential to improve food and nutrition security in these communities.
</summary>
<dc:date>2025-02-03T00:00:00Z</dc:date>
</entry>
<entry>
<title>Distribution, traditional utilization, processing, and health benefits associated with the consumption of morama bean [Tylosema escululetum (Burch.)]: a survey from selected districts of Botswana</title>
<link href="https://hdl.handle.net/13049/801" rel="alternate"/>
<author>
<name>Gwamba, John</name>
</author>
<author>
<name>Imathiu, Samuel</name>
</author>
<author>
<name>Kinyuru, John</name>
</author>
<author>
<name>Onyango, Arnold</name>
</author>
<author>
<name>Motaung, Masa Veronica</name>
</author>
<id>https://hdl.handle.net/13049/801</id>
<updated>2026-08-28T01:06:26Z</updated>
<published>2025-02-04T00:00:00Z</published>
<summary type="text">Distribution, traditional utilization, processing, and health benefits associated with the consumption of morama bean [Tylosema escululetum (Burch.)]: a survey from selected districts of Botswana
Gwamba, John; Imathiu, Samuel; Kinyuru, John; Onyango, Arnold; Motaung, Masa Veronica
Morama bean [Tylosema escululetum (Burch.)] is a nutrient-dense underutilized legume that can address proteinenergy and micronutrient malnutrition in developing countries. An ethnographic study using a snowball sampling method was conducted in Kweneng, Ghanzi, Southern, and Central districts of Botswana. The survey sought to gather and document information about demographic characteristics, traditional use, cultural norms, harvesting, processing, preservation, and health benefits of morama beans. A 5-point Likert-type scale was used to assess and rate the respondent(s) perceptions on traditional utilization and potential of the bean. The data was analyzed using Statistical Package for the Social Sciences (SPSS) and thematic grouping. It was found that morama bean is distributed in Botswana’s sandy desert regions and is consumed by people who are native or migrated into these areas. Roasting in heated sand (mean=4.93) and boiling fresh beans with water or milk (mean=4.49) were the most popular methods of cooking morama beans. Across the four districts, morama bean was found to be an important component in traditional food and medicinal mixtures for undernourished infants, and expectant and lactating mothers, mostly prepared with soft porridge. Respondents cited a significant lack of scientific knowledge about the bean’s medicinal properties (mean=1.27–1.38), indicating the need for additional research. The nutritious density of morama beans (mean=4.87) and their potential for processing into value-added products (mean=4.10) were known to the respondents. As a result, the bean has a high potential to improve food and nutrition security in these communities.
</summary>
<dc:date>2025-02-04T00:00:00Z</dc:date>
</entry>
</feed>
