https://researchhub.buan.ac.bw:443 The ResearchHub digital repository system captures, stores, indexes, preserves, and distributes digital research material. Fri, 13 Mar 2026 05:23:57 GMT 2026-03-13T05:23:57Z https://hdl.handle.net/13049/813 Development of eco-friendly bovine hoof gelatin-cellulose films reinforced with Myrothamnus flabellifolius extract, green-synthesized zinc oxide nanoparticles (ZnO Nps) and β-cyclodextrin nanocomposites. Setlhoka, Modiri D; Motlhanka, Koketso; Mathapa, Baghali G.; Bultosa, Geremew; Nthoiwa, Kereilemang K.; Mmofhe, Kefilwe; Mareko, Molebeledi H. D.; Thema, Force T; Emesu, Pius; Batlhophi, Mpho G. The environmental impact of synthetic polymer and food waste underscores the need to develop sustainable biopolymers for food packaging. This study developed antimicrobial biocomposite films from cow hoof gelatin, microcrystalline cellulose powder, Myrothamnus flabellifolius (MRY) extracts green-synthesized zinc oxide nanoparticles (ZnO NPs) and ZnO NPs/β-cyclodextrin nanocomposites. The ZnO Nps and ZnO/β-CD nanocomposites were characterised using UV-Vis and FTIR spectroscopy. These materials were integrated into composite films, where the insoluble cellulose was incorporated as a dispersed phase via high-shear mixing to act as a reinforcing filler, with glycerol as a plasticizer. The films were evaluated for mechanical, swelling behaviour, water solubility, color, light transmittance and antimicrobial properties of key food pathogens. The findings show that ZnO/β-CD nanocomposites enhanced significantly physical, mechanical and antimicrobial properties of films. Among other performing films, the optimal formulation containing C: gelatin 11% w/v, cellulose 1.5% w/v, glycerol 23% v/v along 1.5% ZnO/β-CD and 5% MRY (C1.5zβ,5e) extract, demonstrated good antimicrobial activity with a mean inhibition zone of 26.54 ± 0.55 mm. Additionally, β-CD complexation improved nanoparticle dispersion and reduced film swelling. The incorporated cellulose contributed to a more compact film structure, improving mechanical integrity of the biocomposite films. Although higher concentrations of MRY extract and glycerol decreased mechanical strength, the optimal film maintained sufficient integrity for packaging applications. The ZnO/β-CD nanocomposite presents an effective strategy for developing antimicrobial packaging. Therefore, the C1.5zβ,5e film can be recommended for active meat packaging and for further evaluation in real food environment. Overall future studies should address issues of higher water solubility of biocomposite films associated with hydrophilic additives. The article is published under Gold Open Access. Tue, 01 Dec 2026 00:00:00 GMT https://hdl.handle.net/13049/813 2026-12-01T00:00:00Z https://hdl.handle.net/13049/812 First report of Passiflora virus Y infecting siratro (Macroptilium atropurpureum) in Botswana. Orebotswe, Oteng; Malambane, Goitseone; Segwagwe, Amogelang; Kelemoge, Donald Omphile; Menzel, Wulf; Abraham, Adane Siratro (Macroptilium atropurpureum (DC.) Urb.) is a perennial legume used as a fodder crop in many countries. In Botswana, the plant occurs wild mainly near ploughed areas and roadsides. Since 2018, viral symptoms including mottling, mosaic with dark/light green, and yellowing of siratro leaves have been observed in the gardens of Botswana University of Agriculture and Natural Resources in Gaborone with 1–5% incidence. Initial testing of five symptomatic samples by antigen-coated Enzyme-Linked Immunosorbent Assay (ACP-ELISA) using potyvirus-specific monoclonal antibody from Agdia gave positive results indicating infection by a potyvirus. To accurately identify the virus species, RNA extracted by Trizol method from three symptomatic siratro samples collected in January 2023 was used in a single-step reverse transcription polymerase chain reaction (RT-PCR) using a pair of primers, LEGPOTY Forward (5-‘GCAGCAATGATCGAAGCATGGG-‘3) and Reverse (5ACCTGCTCATCACCATCCATC− 3’) that amplifies partial NIb and partial CP potyvirus sequences (Webster 2008) and the expected~ 660-bp PCR product was observed. Sanger-sequencing and BLASTN analysis revealed that the sequences were most closely related to those of Passiflora virus Y (species Potyvirus passiflory; PaVY) and had highest nucleotide identity of 98.06% with a Western Australian isolate (Accession No. JF427599). The representative sequence was deposited in public database as GenBank Accession No. PQ333005. PaVY was first reported in Australia and Indonesia in 2004 (Parry et al. 2004) but has since been shown to infect various cultivated and wild passion fruit species as well as legumes including siratro and cultivated crops such as Vigna unguiculata and Pisum sativum in Asia and Australia (Coutts et al. 2011). This is the first report on PaVY and its infection of siratro in Botswana and Africa. Further studies are required to determine its other hosts, especially among cultivated crops and its geographical distribution in the content. Tue, 03 Feb 2026 00:00:00 GMT https://hdl.handle.net/13049/812 2026-02-03T00:00:00Z https://hdl.handle.net/13049/810 Measuring the Immeasurable: Designing and Validating Assessments of Spiritual Intelligence as a Core Component of SEL in Faith-Based School Contexts in Ghana and Botswana. Ntumi, Simon; Bulala, Tapela; Yeboah, Abraham; Agbovor, Divine In an era where holistic education is gaining prominence, spiritual intelligence is emerging as a critical yet under-assessed component of students' personal and social development. This study aimed to develop and validate the Spiritual Intelligence Assessment Tool (SIAT) for cross-cultural application in faith-based educational settings across Ghana and Botswana. Grounded in four theoretical dimensions, spiritual awareness, compassion, ethical decision making, and purpose and meaning, the instrument underwent rigorous psychometric evaluation. Exploratory factor analysis (EFA) revealed a clear four-factor structure explaining 75.8% of the cumulative variance, with eigenvalues ranging from 1.75 to 4.21. Confirmatory factor analysis (CFA) demonstrated excellent model fit (χ²/df = 1.91, CFI = 0.957, TLI = 0.942, RMSEA = 0.043), supporting the factorial validity of SIAT. Internal consistency was high across subscales (Cronbach's α = 0.81–0.87), with composite reliability (CR = 0.83–0.89) and average variance extracted (AVE = 0.53–0.61) indicating strong convergent validity. Discriminant validity was established, as AVE values exceeded maximum shared variance (MSV) for all factors. Measurement invariance testing confirmed configural and metric invariance across Ghana and Botswana, indicating a stable factor structure and equivalent factor loadings across contexts. While scalar and strict invariance showed marginal declines in model fit (ΔCFI = −0.016 and −0.011 respectively), partial support suggests cautious interpretation of latent mean differences. Descriptive statistics revealed higher spiritual intelligence scores among students in Botswana (M = 78.2, SD = 9.4) compared to Ghana (M = 75.3, SD = 10.1), with females consistently outperforming males. ANOVA results indicated significant differences by country (p = 0.031), educational level (p = 0.006), and religious affiliation (p = 0.022), with effect sizes ranging from small to moderate. Overall, the SIAT demonstrated robust psychometric properties and cultural relevance, making it a valid tool for assessing spiritual intelligence among students in sub-Saharan African faith-based educational settings. It is recommended that educational policymakers and school leaders in faith-based institutions should consider incorporating spiritual intelligence into their curricula and student development programs. Thu, 01 Jan 2026 00:00:00 GMT https://hdl.handle.net/13049/810 2026-01-01T00:00:00Z https://hdl.handle.net/13049/809 Breeding objectives, production systems and trait preferences of indigenous Tswana sheep farmers in Botswana: inputs towards community based breeding programs. Bolowe, Monosi Andries; Thutwa, Ketshephaone; Monau, Phetogo Ineeleng; Kgwatalala, Patrick Monametsi There is little information on the involvement of farmers as key stakeholders in the design of successful breeding programs that aim to improve indigenous Tswana sheep production. This study used farmers’ participatory approaches to characterise production systems, breeding practices and trait preferences among farmers raising Tswana sheep in Southern and Central agro-ecological zones (AEZ) of Botswana. A structured questionnaire was administered to 190 farmers. An index-based system was used to rank farmers’ preferred traits and data collected were analysed using SPSS. Demographic data showed that most Southern agro-ecology farmers were unmarried males, possessed secondary education and primarily relied on salaries/wages as household income source. In Central agro-ecology, most farmers were males, widowed, had primary education and livestock sales were the main source of income. Tswana sheep are either kept in extensive or semi-intensive production systems. Most Tswana sheep are kept in extensive production systems and there were no significant differences (P > 0.05) in the most preferred production systems across regions. Most farmers prefer using purebred and crossbred Tswana rams from their own flocks for breeding purposes, which mostly is done throughout the year and is uncontrolled. Farmers from Southern agro-ecology cull sheep with small body size and those in Central region cull sheep based on maladaptation. Keeping sheep for income generation through the sale of animals ranked first across AEZ. The highest-ranking trait preferred amongst Southern region farmers was for economic production traits (large-bodied animals) (0.311) whereas in Central region, preference for adaptation traits ranked highest (0.310). These results are key inputs to designing successful and sustainable community-based breeding programs for indigenous sheep in Botswana. The article is published under Green. Hybrid Gold Open Access Publishing Tue, 16 Dec 2025 00:00:00 GMT https://hdl.handle.net/13049/809 2025-12-16T00:00:00Z