First report of Passiflora virus Y infecting siratro (Macroptilium atropurpureum) in Botswana.

Abstract

Siratro (Macroptilium atropurpureum (DC.) Urb.) is a perennial legume used as a fodder crop in many countries. In Botswana, the plant occurs wild mainly near ploughed areas and roadsides. Since 2018, viral symptoms including mottling, mosaic with dark/light green, and yellowing of siratro leaves have been observed in the gardens of Botswana University of Agriculture and Natural Resources in Gaborone with 1–5% incidence. Initial testing of five symptomatic samples by antigen-coated Enzyme-Linked Immunosorbent Assay (ACP-ELISA) using potyvirus-specific monoclonal antibody from Agdia gave positive results indicating infection by a potyvirus. To accurately identify the virus species, RNA extracted by Trizol method from three symptomatic siratro samples collected in January 2023 was used in a single-step reverse transcription polymerase chain reaction (RT-PCR) using a pair of primers, LEGPOTY Forward (5-‘GCAGCAATGATCGAAGCATGGG-‘3) and Reverse (5ACCTGCTCATCACCATCCATC− 3’) that amplifies partial NIb and partial CP potyvirus sequences (Webster 2008) and the expected~ 660-bp PCR product was observed. Sanger-sequencing and BLASTN analysis revealed that the sequences were most closely related to those of Passiflora virus Y (species Potyvirus passiflory; PaVY) and had highest nucleotide identity of 98.06% with a Western Australian isolate (Accession No. JF427599). The representative sequence was deposited in public database as GenBank Accession No. PQ333005. PaVY was first reported in Australia and Indonesia in 2004 (Parry et al. 2004) but has since been shown to infect various cultivated and wild passion fruit species as well as legumes including siratro and cultivated crops such as Vigna unguiculata and Pisum sativum in Asia and Australia (Coutts et al. 2011). This is the first report on PaVY and its infection of siratro in Botswana and Africa. Further studies are required to determine its other hosts, especially among cultivated crops and its geographical distribution in the content.